
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001170963.1
- Ensembl ID:
- ENSDARG00000075631
- Description:
- putative pa014 protein-like [Source:RefSeq peptide;Acc:NP_001170963]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7257 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7257
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112244 | Essential Splice Site | 14 | 43 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 24 (position 20827014)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 20074143 GRCz11 24 20218562 - KASP Assay ID:
- 554-4440.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAAAAGACATGCTGTACTGCTGTCCATGTTGTCTGCATTCAGATCCAGG[T/G]ATTGAGGRGGAGAGAAGTCCTCATTTAGTGTTTATATAAACATGATTATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: