
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
flrt1b
- Ensembl ID:
- ENSDARG00000075597
- ZFIN ID:
- ZDB-GENE-080327-6
- Description:
- cDNA, clone cssl:d0318 [Source:UniProtKB/TrEMBL;Acc:A8BAV0]
- Human Orthologue:
- FLRT1
- Human Description:
- fibronectin leucine rich transmembrane protein 1 [Source:HGNC Symbol;Acc:3760]
- Mouse Orthologue:
- Flrt1
- Mouse Description:
- fibronectin leucine rich transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:3026647]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
hu3283 | Nonsense | Confirmed mutation in F2 line | Unknown |
sa35756 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- hu3283
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Unknown
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114790 | Nonsense | 83 | 696 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 48861162)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 46938821 GRCz11 14 45926113 - KASP Assay ID:
- 554-0140.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAAAACAACCGCATAGACAATGCTGGGCTACCGACATCTTTAGAGCGA[C/T]GACTGACTGTGAGAGTAGTTTACCTCTATGATAATGAACTTGACGATTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35756
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114790 | Nonsense | 216 | 696 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 48861561)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 46939220 GRCz11 14 45926512 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCCTCTCTAAGGCGTCTCTTCCTGGACGGAAATCTGCTGGCAAATCAA[C/T]GAATTGCAGACGACACATTCTCGCGGCTGTCCAATCTCACAGAGCTTTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: