tnfaip8l2a

Ensembl ID:
ENSDARG00000075592
ZFIN ID:
ZDB-GENE-060616-38
Description:
Tumor necrosis factor, alpha-induced protein 8-like protein 2 A [Source:UniProtKB/Swiss-Prot;Acc:Q1E
Human Orthologue:
TNFAIP8L2
Human Description:
tumor necrosis factor, alpha-induced protein 8-like 2 [Source:HGNC Symbol;Acc:26277]
Mouse Orthologue:
Tnfaip8l2
Mouse Description:
tumor necrosis factor, alpha-induced protein 8-like 2 Gene [Source:MGI Symbol;Acc:MGI:1917019]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36743 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102725 Essential Splice Site 106 186 1 2
Genomic Location (Zv9):
Chromosome 19 (position 389195)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 379126
GRCz11 19 379333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGAAAAAACTGCATCACGGAGCCATGACGGCCATCAGCTTCCAGGAG[G/A]TACTAACACACACACACACACACACACAGAGATACACACATATATACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link