
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ITFG1
- Ensembl ID:
- ENSDARG00000075584
- Description:
- integrin alpha FG-GAP repeat containing 1 [Source:HGNC Symbol;Acc:30697]
- Human Orthologue:
- ITFG1
- Human Description:
- integrin alpha FG-GAP repeat containing 1 [Source:HGNC Symbol;Acc:30697]
- Mouse Orthologue:
- Itfg1
- Mouse Description:
- integrin alpha FG-GAP repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:106419]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11345 | Nonsense | Available for shipment | Available now |
sa14935 | Nonsense | Available for shipment | Available now |
sa14164 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11345
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110907 | Nonsense | 266 | 599 | 9 | 19 |
- Genomic Location (Zv9):
- Chromosome 7 (position 43395405)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 41790112 GRCz11 7 42125477 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTTCCCCCTCAGACGGTGATGGCTTCCAGGACCACCTGTTGCCGGTSTG[T/A]ATGGACGATGYGTGTGCTAAAAGTGCAATATACCTGGCCAGGCCTGGGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14935
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110907 | Nonsense | 408 | 599 | 12 | 19 |
- Genomic Location (Zv9):
- Chromosome 7 (position 43458527)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 41726990 GRCz11 7 42062355 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCATTTGCAGGGWATATTAGATATGATCGTGCTCAGCAAGGTGGAAGGG[A/T]AAGAAGAACTCGTCATCCACGCTTTGAAGAACAACTTTGAGGCCGACGCS
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14164
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110907 | Essential Splice Site | 431 | 599 | 12 | 19 |
- Genomic Location (Zv9):
- Chromosome 7 (position 43458598)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 41726919 GRCz11 7 42062284 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTTTGAAGAACAACTTTGAGGCCGACGCRTATTTCGTGAAAGTCATCGG[T/G]GAGTATTAGATGTGTGKCATTTAGTAGTGATGGGTAATGTCTTATCGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: