zgc:193711

Ensembl ID:
ENSDARG00000075575
ZFIN ID:
ZDB-GENE-081022-34
Description:
hypothetical protein LOC569781 [Source:RefSeq peptide;Acc:NP_001122225]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30398 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113165 Essential Splice Site 37 141 3 4
Genomic Location (Zv9):
Chromosome Zv9_NA347 (position 3142)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56951872
GRCz11 5 57622089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAATGTACTACTTTTATAGCAGCTTCATCTGCAGTTCCTTCCCATCAG[G/A]TGTGTTAAATGAACAGGACACTACAACATTTCACTTTTATTCAACCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link