
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ide
- Ensembl ID:
- ENSDARG00000075570
- ZFIN ID:
- ZDB-GENE-070410-85
- Description:
- insulin-degrading enzyme [Source:RefSeq peptide;Acc:NP_001082994]
- Human Orthologue:
- IDE
- Human Description:
- insulin-degrading enzyme [Source:HGNC Symbol;Acc:5381]
- Mouse Orthologue:
- Ide
- Mouse Description:
- insulin degrading enzyme Gene [Source:MGI Symbol;Acc:MGI:96412]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42283 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa35572 | Essential Splice Site | Available for shipment | Available now |
sa28188 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15036 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42283
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113215 | Nonsense | 43 | 998 | 2 | 25 |
- Genomic Location (Zv9):
- Chromosome 13 (position 42965062)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 42186021 GRCz11 13 42312081 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAGGGTGGTGAGTGATATCATTCGCTCTCCAGAAGACAAACGGGAGTA[T/G]CGAGGACTCGAGTTTACAAATGGTCTGAAAGCCATTCTCATCAGTGACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35572
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113215 | Essential Splice Site | 490 | 998 | 12 | 25 |
- Genomic Location (Zv9):
- Chromosome 13 (position 42982210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 42203169 GRCz11 13 42329229 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTACGGCACACAGTATAAACAAGAAGCCATTACTGATGAAGCTATTAAGG[T/C]GAAGCGCGTTTGATTTTAGCAAATCTCTCTCTCTAGTATGTCATGGTACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28188
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113215 | Nonsense | 774 | 998 | 20 | 25 |
ENSDART00000113215 | Nonsense | 774 | 998 | 20 | 25 |
- Genomic Location (Zv9):
- Chromosome 13 (position 42994103)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 42215062 GRCz11 13 42341122 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACCAGCAGAGGAACGAGGTTCATAATAACTGTGGGATCGAGATTTACTA[T/G]CAGACTGACATGCAGAACACCCATGAGAACATGCTGCTGGAGCTCTTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15036
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113215 | Nonsense | 774 | 998 | 20 | 25 |
ENSDART00000113215 | Nonsense | 774 | 998 | 20 | 25 |
- Genomic Location (Zv9):
- Chromosome 13 (position 42994103)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 42215062 GRCz11 13 42341122 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACCAGCAGAGRAACGAGGTTCATAATAACTGTGGGATCGAGATTTACTA[T/A]CAGACTGACATGCAGAACACCCATGAGAACATGCTGCTGGAGCTCTTCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Airflow obstruction : Genome-wide association studies identify CHRNA5/3 and HTR4 in the development of airflow obstruction. (View Study)
- Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: