si:dkey-63d15.13

Ensembl ID:
ENSDARG00000075565
ZFIN ID:
ZDB-GENE-081104-431
Description:
Novel protein similar to vertebrate leucine zipper, putative tumor suppressor [Source:UniProtKB/TrEM
Human Orthologue:
LZTS1
Human Description:
leucine zipper, putative tumor suppressor 1 [Source:HGNC Symbol;Acc:13861]
Mouse Orthologue:
Lzts1
Mouse Description:
leucine zipper, putative tumor suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2684762]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18144 Nonsense Available for shipment Available now
sa41266 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113511 Nonsense 326 627 4 7
ENSDART00000142557 Nonsense 69 323 2 4
Genomic Location (Zv9):
Chromosome 8 (position 41523564)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39537144
GRCz11 8 39570918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACAGAATTCACCTTTGTTACGCTTATTWGTGTAACCTGCAGGTGTCC[C/T]AAAGGGCTGTGAAAGCCCAACAGTTATTGCAGCTTCAGGTGATACAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113511 Nonsense 385 627 4 7
ENSDART00000142557 Nonsense 128 323 2 4
Genomic Location (Zv9):
Chromosome 8 (position 41523743)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39537323
GRCz11 8 39571097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTATGAAAGCCAGAAAAATCTTGTACCCACATTAGAGGAGACGCAGTG[G/A]GAGGTCAGTCGCTAAAAACTTGCTGTGGTATGATGACAAATGTGAATGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link