si:ch211-10e2.6
- Ensembl ID:
- ENSDARG00000075543
- ZFIN ID:
- ZDB-GENE-030131-6320
- Description:
- Chromodomain-helicase-DNA-binding protein 8 [Source:UniProtKB/Swiss-Prot;Acc:B0R0I6]
- Human Orthologue:
- CHD8
- Human Description:
- chromodomain helicase DNA binding protein 8 [Source:HGNC Symbol;Acc:20153]
- Mouse Orthologue:
- Chd8
- Mouse Description:
- chromodomain helicase DNA binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1915022]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa25869 |
Essential Splice Site, Missense |
Mutation detected in F1 DNA |
During 2018 |
sa19827 |
Nonsense |
Available for shipment |
Available now |
sa19826 |
Nonsense |
Available for shipment |
Available now |
sa32979 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa31293 |
Nonsense |
Available for shipment |
Available now |
sa38345 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa25869
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site, Missense
- Genomic Location (Zv9):
- Chromosome 2 (position 37818217)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
38133131 |
GRCz11 |
2 |
38115459 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCACTGCAAAACCTTCAAACTCAGCAGCTCAGCCAGATCCCCCATGAGG[T/C]CTCTGTTGCCTCTGCTCCCATTTCCATTCAGCCCTCCCTCTCGGTGGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19827
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37817825)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
38132739 |
GRCz11 |
2 |
38115067 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAATGCGACATCTCCTGCGCAGGGGCAGGTCAAAGTTGGCACTGGAGTA[C/T]AAAGGCTGGTTCAAACTGCAAATGGCCCAATGAAACAGGTGTTACTGACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19826
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37804136)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
38119050 |
GRCz11 |
2 |
38101378 |
- KASP Assay ID:
- 2259-2391.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCCTTTTTCTGTCTTTTAGGGTTTTGCTGAGAGTACGTATGCTTTATTA[T/A]CTGAAGCAGGAGGTCATTGGAGAACATGCTGATTCTGTATTGAGTGGAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32979
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 37802083)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
38116997 |
GRCz11 |
2 |
38099325 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGGGATGCTGATGACTGATGTGTTTTTCACTCTGTATCTTGTTATTTTC[A/T]GGATATGAGATGTACACCACCATGCGTGCAGACCCCTGCTTGTGTTTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31293
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37801447)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
38116361 |
GRCz11 |
2 |
38098689 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTTAAGATCGAGGCAGCAGAGAAGGGGGACCGTAGGCGAAGACGCTGC[G/T]AACAAGCTACCAAACTCAAAGAGATAGCCAGACAAGAGCGACAGCAACGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38345
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 37797875)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
38112789 |
GRCz11 |
2 |
38095117 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTCTGTCCGTCAGACTCTCCGGCCATGCTGCTCTCTCATTCTGACAGC[A/T]AAGTTGGCATTCAGGCTGGCTGGGTCTGGAAGAAGAGCAAAAACAACGGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: