zfhx4

Ensembl ID:
ENSDARG00000075542
ZFIN ID:
ZDB-GENE-070530-3
Human Orthologue:
ZFHX4
Human Description:
zinc finger homeobox 4 [Source:HGNC Symbol;Acc:30939]
Mouse Orthologue:
Zfhx4
Mouse Description:
zinc finger homeodomain 4 Gene [Source:MGI Symbol;Acc:MGI:2137668]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14684 Nonsense Available for shipment Available now
sa37890 Nonsense Mutation detected in F1 DNA During 2018
sa44138 Nonsense Mutation detected in F1 DNA During 2018
sa37889 Nonsense Available for shipment Available now
sa14535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112256 Nonsense 307 3528 1 9
ENSDART00000135846 Nonsense 307 3528 2 10
Genomic Location (Zv9):
Chromosome 24 (position 23911750)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23158628
GRCz11 24 23303802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACCCAYGCTGTGCATGATCATCGGATGACCCTCAATGAGCAGGAGCAA[A/T]AGCTCCTTAGTAATAAATATGTCTCTGCCATCATACAGGGCATTGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112256 Nonsense 313 3528 1 9
ENSDART00000135846 Nonsense 313 3528 2 10
Genomic Location (Zv9):
Chromosome 24 (position 23911730)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23158608
GRCz11 24 23303782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGGATGACCCTCAATGAGCAGGAGCAAAAGCTCCTTAGTAATAAATA[T/A]GTCTCTGCCATCATACAGGGCATTGGTAAAGACAAAGAACCTCTTATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112256 Nonsense 1266 3528 7 9
ENSDART00000135846 Nonsense 1266 3528 8 10
Genomic Location (Zv9):
Chromosome 24 (position 23860413)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23107291
GRCz11 24 23252465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGATCTTCCAGTGCCCAGTTCCTTGCTGTCTGCATCATTACAAGAC[A/T]AAGTCCCATCCCTGATGGATACTTCAGCTGTTAACCCAGAGGGATCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112256 Nonsense 1708 3528 8 9
ENSDART00000135846 Nonsense 1708 3528 9 10
Genomic Location (Zv9):
Chromosome 24 (position 23858961)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23105839
GRCz11 24 23251013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAAGCACTACTGCAATTCCAGCAGCCCCAGTTCCTCTTCCCATTTTA[C/A]ATTCCTGGTGCTGAATTTAACATCAGCCCCGAGCTTGCATTGCATTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112256 Nonsense 2207 3528 8 9
ENSDART00000135846 Nonsense 2207 3528 9 10
Genomic Location (Zv9):
Chromosome 24 (position 23857466)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23104344
GRCz11 24 23249518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAGGATGATGAAATTGAGCAGCTCTCCACGGTACTCAACCTGCCAACA[C/T]GAGTGATTGTGGTGTGGTTCCAAAATGCCMGACAAAAGGCCCGCAAGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link