cpne1

Ensembl ID:
ENSDARG00000075536
ZFIN IDs:
ZDB-GENE-030131-3562, ZDB-GENE-030131-3562
Description:
copine-1 [Source:RefSeq peptide;Acc:NP_955993]
Human Orthologue:
CPNE1
Human Description:
copine I [Source:HGNC Symbol;Acc:2314]
Mouse Orthologue:
Cpne1
Mouse Description:
copine I Gene [Source:MGI Symbol;Acc:MGI:2386621]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44741 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087652 Essential Splice Site 1 533 2 16
ENSDART00000103513 Essential Splice Site 1 534 2 16
Genomic Location (Zv9):
Chromosome 11 (position 27323823)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26152648
GRCz11 11 26390264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGCCAAATCTTAATACATGTTTTTATCTGTTGTGTTTTTTTTTTTCA[G/T]ATGGCCGCTCAGTGTGTGTCCAAAGTCGAGCTCTCCATCTCTTGTAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link