si:dkey-234k24.1

Ensembl ID:
ENSDARG00000075521
ZFIN ID:
ZDB-GENE-090313-267
Description:
Novel protein similar to H.sapiens CPZ, carboxypeptidase Z (CPZ) [Source:UniProtKB/TrEMBL;Acc:B8JHZ8
Human Orthologue:
CPZ
Human Description:
carboxypeptidase Z [Source:HGNC Symbol;Acc:2333]
Mouse Orthologue:
Cpz
Mouse Description:
carboxypeptidase Z Gene [Source:MGI Symbol;Acc:MGI:88487]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44510 Nonsense Mutation detected in F1 DNA During 2018
sa1708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109165 Nonsense 370 681 6 11
ENSDART00000133075   None 305 None 5
ENSDART00000147497   None 294 None 5
Genomic Location (Zv9):
Chromosome 1 (position 41192883)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40109124
GRCz11 1 40811911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCAACTTCCCTGACCTCACATCCATCTTCTACAACCGGCGTCGTTTT[C/T]GACATTTTCGTAGTGACCACATCCCCATCCCTGACTCCTACTGGATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109165 Nonsense 499 681 9 11
ENSDART00000133075   None 305 None 5
ENSDART00000147497 Nonsense 112 294 3 5
Genomic Location (Zv9):
Chromosome 1 (position 41195257)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40111498
GRCz11 1 40814285
KASP Assay ID:
554-1654.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYTACTGTATCAGGGATGTCAGACTTTAATTACCTGCACAGTAACTGTTA[T/A]GAGATCACGGTGGAGCTGGGCTGTGAYAAATTCCCCTCTGAGGAAGAGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link