wu:fi27d05

Ensembl ID:
ENSDARG00000075504
ZFIN ID:
ZDB-GENE-030131-5958
Human Orthologue:
DTX3
Human Description:
deltex homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:24457]
Mouse Orthologue:
Dtx3
Mouse Description:
deltex 3 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135752]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16636 Nonsense Available for shipment Available now
sa5835 Nonsense Mutation detected in F1 DNA During 2018
sa6187 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112597 Nonsense 32 1006 3 18
Genomic Location (Zv9):
Chromosome 11 (position 1552279)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1560419
GRCz11 11 1587007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACTTTTAMTATCACAAACTGAGTTGYATTCTTGCTCTTCCAGATTTA[T/A]CAAAATGTGATCCAAACACAACCGACCAGCRTTAAAAATTCTCCTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112597 Nonsense 893 1006 16 18
Genomic Location (Zv9):
Chromosome 11 (position 1570050)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1578190
GRCz11 11 1604778
KASP Assay ID:
554-3788.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAAGGAACAATGCAGGTCAACAAAAGCAGTTTGAGTCTCCCYGGATA[T/A]CCACACTGYGGCTCTATTGAAATCCTCTACAACATACCCAGCGGTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112597 Essential Splice Site 984 1006 17 18
Genomic Location (Zv9):
Chromosome 11 (position 1570601)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1578741
GRCz11 11 1605329
KASP Assay ID:
554-4451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGGAATGATATCCATCATAARACMAGTCMATWTGGTGGAGCTCAAAGG[T/A]ATGAGTTCATCTCTAAAATCTGMTTGCATRCTTAACCAGAAATCAAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link