vwa1

Ensembl ID:
ENSDARG00000075468
ZFIN ID:
ZDB-GENE-030131-5921
Human Orthologue:
VWA1
Human Description:
von Willebrand factor A domain containing 1 [Source:HGNC Symbol;Acc:30910]
Mouse Orthologue:
Vwa1
Mouse Description:
von Willebrand factor A domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2179729]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1381 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110868   453 503 5 6
ENSDART00000144439 Nonsense 31 84 1 2

The following transcripts of ENSDARG00000075468 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39781630)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39743195
GRCz11 23 39636106
KASP Assay ID:
554-1293.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCAGCTGCGCTGGAAGGGAAGTTTCGACGGGCTTCGTGGATACTGGGT[C/A]ACTTGGGAGCGAGGACACAGCCAGCGCTCCACCCTGTACTTACCACCCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link