zgc:158294

Ensembl ID:
ENSDARG00000075467
ZFIN ID:
ZDB-GENE-070112-2022
Description:
hypothetical protein LOC791180 [Source:RefSeq peptide;Acc:NP_001074131]
Human Orthologue:
SHISA3
Human Description:
shisa homolog 3 (Xenopus laevis) [Source:HGNC Symbol;Acc:25159]
Mouse Orthologue:
Shisa3
Mouse Description:
shisa homolog 3 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:3041225]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19094 Nonsense Mutation detected in F1 DNA During 2018
sa8804 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110191 Nonsense 191 279 2 2
ENSDART00000110191 Nonsense 191 279 2 2
Genomic Location (Zv9):
Chromosome 14 (position 48141918)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46216295
GRCz11 14 45203497
KASP Assay ID:
2260-7881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGAGCTCGCTCCGCCGCTTCTCCCTGGGCCGCAGTGAAACGATGGGT[C/T]AATGTTCACAACATCATCAACACCAACAGCAGCAGCTCATGGCGGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110191 Nonsense 191 279 2 2
ENSDART00000110191 Nonsense 191 279 2 2
Genomic Location (Zv9):
Chromosome 14 (position 48141918)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46216295
GRCz11 14 45203497
KASP Assay ID:
2260-7881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGAGCTCGCTCCGCCGCTWCTCCCTGGGCCGCAGTGAAACGATGGGT[C/T]AATGTTCACAACATCATCAACACCAACAGCAGCAGCNNNNNNTCATGGCGGTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link