ZMYND17

Ensembl ID:
ENSDARG00000075463
Description:
zinc finger, MYND-type containing 17 [Source:HGNC Symbol;Acc:21000]
Human Orthologue:
ZMYND17
Human Description:
zinc finger, MYND-type containing 17 [Source:HGNC Symbol;Acc:21000]
Mouse Orthologue:
Zmynd17
Mouse Description:
zinc finger, MYND domain containing 17 Gene [Source:MGI Symbol;Acc:MGI:1922093]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13606 Essential Splice Site Available for shipment Available now
sa10126 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115297 Essential Splice Site 50 413 2 6
Genomic Location (Zv9):
Chromosome 24 (position 40671760)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39203992
GRCz11 24 39091700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAAATGAGTGTGCAGCATTRACAGGTTGTCAATATTTCTCTTTTTTTC[A/T]GGGAAGCGCTGGAAGGCAAAGGCAAGGTGGGATTTCGCTCTCACWAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115297 Nonsense 119 413 3 6
Genomic Location (Zv9):
Chromosome 24 (position 40676607)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39208839
GRCz11 24 39096547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGTATTACTGCAGTAAAGAGTGTCAAAAGACGGACTGGTCTTTGCAT[A/T]AGAAGTTCTGCAAGATGCTCCATAAGGTCTCCATTGACAGGCTGGTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link