zgc:195224

Ensembl ID:
ENSDARG00000075455
ZFIN ID:
ZDB-GENE-081022-198
Description:
Zgc:195224 [Source:UniProtKB/TrEMBL;Acc:B3DIQ0]
Human Orthologues:
C6orf174, RP3-403A15.5
Human Descriptions:
C6orf174 protein [Source:UniProtKB/TrEMBL;Acc:A5PLQ8]
chromosome 6 open reading frame 174 [Source:HGNC Symbol;Acc:21494]
Mouse Orthologue:
6330407J23Rik
Mouse Description:
RIKEN cDNA 6330407J23 gene Gene [Source:MGI Symbol;Acc:MGI:1914662]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29996 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113106 Nonsense 199 210 1 2
ENSDART00000121587 Nonsense 200 807 1 12
ENSDART00000140136 Nonsense 199 811 1 6
Genomic Location (Zv9):
Chromosome 23 (position 40727033)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40559887
GRCz11 23 40452791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCGAAGAGGTTATGACACAGCAGGATGAAGCCCTGCAGGAGGAGATC[G/T]AAAGGCTGGAGGACGAAAACGACGAGCTTAAGGTTTGAAAGCCATGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link