vwa2

Ensembl ID:
ENSDARG00000075441
ZFIN IDs:
ZDB-GENE-100302-1, ZDB-GENE-100302-1, ZDB-GENE-100302-1
Description:
Vwa2 protein [Source:UniProtKB/TrEMBL;Acc:D2DUP6]
Human Orthologue:
VWA2
Human Description:
von Willebrand factor A domain containing 2 [Source:HGNC Symbol;Acc:24709]
Mouse Orthologue:
Vwa2
Mouse Description:
von Willebrand factor A domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2684334]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22127 Essential Splice Site Available for shipment Available now
sa22126 Essential Splice Site Available for shipment Available now
sa18645 Essential Splice Site Available for shipment Available now
sa15844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113860 Essential Splice Site 33 740 1 11
ENSDART00000128459   None 38 None 2
ENSDART00000130199   None 260 None 3
ENSDART00000113860 Essential Splice Site 33 740 1 11
ENSDART00000128459   None 38 None 2
ENSDART00000130199   None 260 None 3
Genomic Location (Zv9):
Chromosome 12 (position 31908869)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30218212
GRCz11 12 30333114
KASP Assay ID:
554-4404.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAAACGGATCTTGACACCATTATGAAGATCAACGCTGCTGGAGAAAG[T/A]GAGTTTTGGACTTGAAAGCAATGAGTTGTGTTCATCAATGAGTATGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113860 Essential Splice Site 77 740 2 11
ENSDART00000128459   None 38 None 2
ENSDART00000130199   None 260 None 3
Genomic Location (Zv9):
Chromosome 12 (position 31906745)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30216088
GRCz11 12 30330990
KASP Assay ID:
2260-5530.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTACATGTTGAAGCTTTGTGAGGCTCTTGATGTCCGCCAAGACAAG[G/A]TCAGACTGGATAAAGTCTATTTAAGATAGAAAGGTTCACCCAGAATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113860 Essential Splice Site 514 740 9 11
ENSDART00000128459   None 38 None 2
ENSDART00000130199   None 260 None 3
Genomic Location (Zv9):
Chromosome 12 (position 31892685)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30202028
GRCz11 12 30316930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAAGATCCCAGAACTAAGAGCCAAAATYTGCAGCGTCGACAACCAGG[G/A]TAGAGAGCTAATCTATTTTTYATTGTCAMCACAGGAAAGTCTTTAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113860 Nonsense 535 740 10 11
ENSDART00000128459   None 38 None 2
ENSDART00000130199 Nonsense 18 260 1 3
Genomic Location (Zv9):
Chromosome 12 (position 31890821)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30200164
GRCz11 12 30315066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTCAGGCTCTGGACCTTGTGTTTGTTCTGGATGCCTCCAGTGGTRTYGGC[A/T]AGGAGAATTTCATTCACTTTCAGGATTTTGTTCGGAGCACTTCAGTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link