si:dkey-246i14.4

Ensembl ID:
ENSDARG00000075437
ZFIN ID:
ZDB-GENE-030131-2538
Human Orthologue:
SHC1
Human Description:
SHC (Src homology 2 domain containing) transforming protein 1 [Source:HGNC Symbol;Acc:10840]
Mouse Orthologue:
Shc1
Mouse Description:
src homology 2 domain-containing transforming protein C1 Gene [Source:MGI Symbol;Acc:MGI:98296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36114 Nonsense Mutation detected in F1 DNA During 2018
sa36113 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098400 Nonsense 280 554 10 15
ENSDART00000147609 Nonsense 185 449 8 13

The following transcripts of ENSDARG00000075437 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24973466)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22877782
GRCz11 16 22793172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTATCCTGTGTTGTAGCGTGTCATATCCTGGAGTGCTCTGAAGGCT[T/A]GGCTCAGGAGGTCATCAGCACCATAGGTCAGGCTTTCGAGCTCCGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098400 Essential Splice Site 366 554 12 15
ENSDART00000147609   None 449 None 13

The following transcripts of ENSDARG00000075437 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24969973)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22874289
GRCz11 16 22789679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGAATTAAATTGCTTTGTTCATTCATGAAACACCCACACTGAATAAA[T/C]ATGTCACCATCCCACTGCACTGTATCTCCACAGCCCTATGGACAGCCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link