zgc:76871

Ensembl ID:
ENSDARG00000075434
ZFIN ID:
ZDB-GENE-040426-2096
Description:
UPF0027 protein C22orf28 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NZS4]
Human Orthologue:
C22orf28
Human Description:
chromosome 22 open reading frame 28 [Source:HGNC Symbol;Acc:26935]
Mouse Orthologue:
D10Wsu52e
Mouse Description:
DNA segment, Chr 10, Wayne State University 52, expressed Gene [Source:MGI Symbol;Acc:MGI:106379]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33351 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111348 Essential Splice Site 166 505 6 12

The following transcripts of ENSDARG00000075434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 388221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGAAGTGAATGAGAGGATCTGCAGTACAGTCTGTGTGTGTGTGTGCA[G/T]GGACCTGGAGGAGGCGTTGGAGATGGGTGTGGACTGGTCTCTGAGGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link