si:dkey-51p7.1

Ensembl ID:
ENSDARG00000075394
ZFIN ID:
ZDB-GENE-090312-28
Description:
Novel protein similar to H.sapiens CRTAC1, cartilage acidic protein 1 (CRTAC1) [Source:UniProtKB/TrE
Human Orthologue:
CRTAC1
Human Description:
cartilage acidic protein 1 [Source:HGNC Symbol;Acc:14882]
Mouse Orthologue:
Crtac1
Mouse Description:
cartilage acidic protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920082]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45499 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa28184 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa1879 Essential Splice Site Available for shipment Available now
sa5867 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115286 Splice Site None 644 None 14
ENSDART00000132048 Essential Splice Site 134 527 2 11
Genomic Location (Zv9):
Chromosome 13 (position 40979573)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40010541
GRCz11 13 40136431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGAGGAAATTTACGTCCTCAACACTAATAATGCCTTTTCAGGTATG[T/A]AACGGTTTCACAAACAAGGCACTGAAGCAAATGCTACAGTAAATGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115286 Missense 146 644 3 14
ENSDART00000132048 Essential Splice Site 134 527 None 11
Genomic Location (Zv9):
Chromosome 13 (position 40979485)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40010453
GRCz11 13 40136343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAATGGATTTTAGTTTCATGTAATTGTTTCTGTCATTTCATCCAGGG[A/G]GAGCGACATACACTGACAAGCTCTTTAAGTTTCGTAATGGCCGGTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115286 Essential Splice Site 242 644 4 14
ENSDART00000132048 Essential Splice Site 230 527 4 11
Genomic Location (Zv9):
Chromosome 13 (position 40961133)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39994205
GRCz11 13 40120095
KASP Assay ID:
554-1869.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGYGCTGTCCAATGTGGCCGAGCAGGCCGGAGTCAACAAGTTCACAG[G/A]TGTGTGTCTACGTTATTTACAAATGCTTGAGTGTGTGTATACCTTCAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa5867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115286 Essential Splice Site 443 644 9 14
ENSDART00000132048 Essential Splice Site 431 527 9 11
Genomic Location (Zv9):
Chromosome 13 (position 40939426)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39972498
GRCz11 13 40098388
KASP Assay ID:
554-3928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGGCGAAAGTGCAGCACAACCCATYTCTGTGTATCGAGTCACTCAGG[T/C]GAGAATGTGCGTCAGACACTTTTAAATTTGGGAGTTAAGTTCGATTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link