
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-51p7.1
- Ensembl ID:
- ENSDARG00000075394
- ZFIN ID:
- ZDB-GENE-090312-28
- Description:
- Novel protein similar to H.sapiens CRTAC1, cartilage acidic protein 1 (CRTAC1) [Source:UniProtKB/TrE
- Human Orthologue:
- CRTAC1
- Human Description:
- cartilage acidic protein 1 [Source:HGNC Symbol;Acc:14882]
- Mouse Orthologue:
- Crtac1
- Mouse Description:
- cartilage acidic protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920082]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45499 | Essential Splice Site, Splice Site | Mutation detected in F1 DNA | During 2018 |
sa28184 | Essential Splice Site, Missense | Mutation detected in F1 DNA | During 2018 |
sa1879 | Essential Splice Site | Available for shipment | Available now |
sa5867 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45499
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site, Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115286 | Splice Site | None | 644 | None | 14 |
ENSDART00000132048 | Essential Splice Site | 134 | 527 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 40979573)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 40010541 GRCz11 13 40136431 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGGGAGGAAATTTACGTCCTCAACACTAATAATGCCTTTTCAGGTATG[T/A]AACGGTTTCACAAACAAGGCACTGAAGCAAATGCTACAGTAAATGGATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28184
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115286 | Missense | 146 | 644 | 3 | 14 |
ENSDART00000132048 | Essential Splice Site | 134 | 527 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 40979485)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 40010453 GRCz11 13 40136343 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTAAATGGATTTTAGTTTCATGTAATTGTTTCTGTCATTTCATCCAGGG[A/G]GAGCGACATACACTGACAAGCTCTTTAAGTTTCGTAATGGCCGGTATGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1879
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115286 | Essential Splice Site | 242 | 644 | 4 | 14 |
ENSDART00000132048 | Essential Splice Site | 230 | 527 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 40961133)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 39994205 GRCz11 13 40120095 - KASP Assay ID:
- 554-1869.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTCGYGCTGTCCAATGTGGCCGAGCAGGCCGGAGTCAACAAGTTCACAG[G/A]TGTGTGTCTACGTTATTTACAAATGCTTGAGTGTGTGTATACCTTCAATG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa5867
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115286 | Essential Splice Site | 443 | 644 | 9 | 14 |
ENSDART00000132048 | Essential Splice Site | 431 | 527 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 13 (position 40939426)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 39972498 GRCz11 13 40098388 - KASP Assay ID:
- 554-3928.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATGGCGAAAGTGCAGCACAACCCATYTCTGTGTATCGAGTCACTCAGG[T/C]GAGAATGTGCGTCAGACACTTTTAAATTTGGGAGTTAAGTTCGATTATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Metabolic syndrome: A genome-wide association study of the metabolic syndrome in Indian Asian men. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: