zgc:171501

Ensembl ID:
ENSDARG00000075375
ZFIN ID:
ZDB-GENE-080204-10
Description:
hypothetical protein LOC571061 [Source:RefSeq peptide;Acc:NP_001104673]
Human Orthologue:
MFSD2A
Human Description:
major facilitator superfamily domain containing 2A [Source:HGNC Symbol;Acc:25897]
Mouse Orthologue:
Mfsd2a
Mouse Description:
major facilitator superfamily domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1923824]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34495 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114584 Nonsense 317 600 9 14
ENSDART00000142172   None 236 None 6
Genomic Location (Zv9):
Chromosome 8 (position 51444182)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49194569
GRCz11 8 49183338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATGTCTTTAGGCAACTTTACACTGTTTTGCTCGCATGTTGCTGGTT[T/G]AGGAGCTCAATTCCAGCATCTCATGTTGGCTATACTGGTAAGTCTGAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link