wu:fl55e11

Ensembl ID:
ENSDARG00000075354
ZFIN ID:
ZDB-GENE-030131-6494
Human Orthologue:
ESPL1
Human Description:
extra spindle pole bodies homolog 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:16856]
Mouse Orthologue:
Espl1
Mouse Description:
extra spindle poles-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146156]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40750 Nonsense Mutation detected in F1 DNA During 2018
sa16840 Essential Splice Site Available for shipment Available now
sa40749 Nonsense Mutation detected in F1 DNA During 2018
sa40748 Nonsense Mutation detected in F1 DNA During 2018
sa20766 Nonsense Available for shipment Available now
sa33916 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112361 Nonsense 378 2182 4 31
Genomic Location (Zv9):
Chromosome 6 (position 39628840)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39700440
GRCz11 6 39697976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAATTTTTTTCTTAAAGTCTTGTGTGTTTATTTTCCAGAACTCGTTTT[C/A]GCTGCAGGTCCAATACTCTCTTTGTTTCAGTTTTTACCAGGGCTTCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112361 Essential Splice Site 549 2182 7 31
Genomic Location (Zv9):
Chromosome 6 (position 39626357)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39697957
GRCz11 6 39695493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTAAGTGTGATGCCGCCAGAGCAGGCGAGGATGACACACGCCTGAGG[T/C]AACTTGCAMTTTAAAATAAGGCTTCYGKTATACTTCTTAATTGCCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112361 Nonsense 1445 2182 18 31
Genomic Location (Zv9):
Chromosome 6 (position 39613784)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39685384
GRCz11 6 39682920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTCTCCTGCTGCAGAGAAAGCTGTAGTTGTCCCGGCTGCTCCTAAA[C/T]GAACAAAGCGTTCTCGCTTCAAGGTTGGACTCATTTTGTCTTTAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112361 Nonsense 1458 2182 19 31
Genomic Location (Zv9):
Chromosome 6 (position 39613660)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39685260
GRCz11 6 39682796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACCCTAATCTATCATACATCTGATCTCTTTCAGGTTGAGTTCAGCGAT[G/T]AAAGCGACAACGATGCTGCTCCTCTTGCTGTAATGGAAAAGTCAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112361 Nonsense 1822 2182 24 31
Genomic Location (Zv9):
Chromosome 6 (position 39610161)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39681761
GRCz11 6 39679297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGACAGTTTAATTTTATTTTCTATTTAGCAATCTGTTGCTGGCCTGT[T/A]GGAAGAAATGGATGGAGTCTTGAAAGGACAAAAGGAAGTGAGCACAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112361 Nonsense 1960 2182 27 31
Genomic Location (Zv9):
Chromosome 6 (position 39606716)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39678316
GRCz11 6 39675852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGATTCAATATGGAGGTTTTGATCTAACCGCAGTGTTTGTGCAGTA[C/A]TTGCAGAGGTTGCCGTGGGAGAACATTGCTTGTCTGAAGTCTCAGTCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link