si:dkey-69h6.7

Ensembl ID:
ENSDARG00000075347
ZFIN ID:
ZDB-GENE-030131-3522
Description:
E3 ubiquitin-protein ligase CHFR [Source:UniProtKB/Swiss-Prot;Acc:A5WW08]
Human Orthologue:
CHFR
Human Description:
checkpoint with forkhead and ring finger domains [Source:HGNC Symbol;Acc:20455]
Mouse Orthologue:
Chfr
Mouse Description:
checkpoint with forkhead and ring finger domains Gene [Source:MGI Symbol;Acc:MGI:2444898]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31420 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110783 Essential Splice Site 184 637 6 18
ENSDART00000115227 Essential Splice Site 184 637 6 19
Genomic Location (Zv9):
Chromosome 5 (position 19576448)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17293940
GRCz11 5 17797936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCTCTTCCTTACACTTCTACAACATGCCATTGTCTACCTGCTCTGG[T/C]AATTACCACGCTGCTTTAATAAGTTAAATGACTTCATTGACCCCTTAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link