CP089_DANRE

Ensembl ID:
ENSDARG00000075345
Description:
UPF0764 protein C16orf89 homolog [Source:UniProtKB/Swiss-Prot;Acc:A7MCS3]
Human Orthologue:
C16orf89
Human Description:
chromosome 16 open reading frame 89 [Source:HGNC Symbol;Acc:28687]
Mouse Orthologue:
AU021092
Mouse Description:
expressed sequence AU021092 Gene [Source:MGI Symbol;Acc:MGI:2146559]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45141 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114319 Essential Splice Site 116 355 2 8
Genomic Location (Zv9):
Chromosome 3 (position 29005108)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 28723147
GRCz11 3 28853989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTACTGCGGCCAGCACCCTTCAGGAGACAGACCCCAAATACTTCAAAG[G/T]TAAAACTCTTTAAACAGATTGAAAACTTTTTAGATTAATGACATAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link