zgc:165522

Ensembl ID:
ENSDARG00000075337
ZFIN ID:
ZDB-GENE-070928-3
Description:
probable leucyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_001099171]
Human Orthologue:
LARS2
Human Description:
leucyl-tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:17095]
Mouse Orthologue:
Lars2
Mouse Description:
leucyl-tRNA synthetase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2142973]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12428 Nonsense Available for shipment Available now
sa32070 Nonsense Available for shipment Available now
sa36017 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109980 Nonsense 164 574 5 13
Genomic Location (Zv9):
Chromosome 16 (position 3531039)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2689415
GRCz11 16 2927081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGACNNNNTCCATGTRAATGTTGTCTCTGCTTTATCAGGAGAYCACCACGTG[T/A]CTGMCGGATTATTATAAGTGGACTCAGTATCTGTTTATCAAGATGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109980 Nonsense 283 574 8 13
Genomic Location (Zv9):
Chromosome 16 (position 3553147)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2711149
GRCz11 16 2948815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTTGGCTTGTGTTCATCAGGTGGACGGTCGTGACACAGGCGAGGTGT[T/A]GTCTGCGTACTCTTCTTCTCCAGAAACTGTGTTCGGAGCCGCTTATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109980 Nonsense 379 574 10 13
Genomic Location (Zv9):
Chromosome 16 (position 3555018)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2713020
GRCz11 16 2950686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCCAGACAGCAGTGAGGAGGAAGCAGCGGTGGCTCAGTCTCTTGGTT[T/A]GAGCTGGAGCAGCGTTCTGAAGACTGAAGCTGATGGCACACACACTCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link