si:dkey-287f10.3

Ensembl ID:
ENSDARG00000075334
ZFIN ID:
ZDB-GENE-060503-918
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZ82]
Human Orthologue:
ARHGAP32
Human Description:
Rho GTPase activating protein 32 [Source:HGNC Symbol;Acc:17399]
Mouse Orthologue:
Arhgap32
Mouse Description:
Rho GTPase activating protein 32 Gene [Source:MGI Symbol;Acc:MGI:2450166]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35857 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32026 Essential Splice Site Available for shipment Available now
sa35856 Nonsense Available for shipment Available now
sa12990 Essential Splice Site Available for shipment Available now
sa28431 Nonsense Mutation detected in F1 DNA During 2018
sa17301 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108818 Essential Splice Site 30 1676 None 21
ENSDART00000136263 Essential Splice Site 30 119 None 5
Genomic Location (Zv9):
Chromosome 15 (position 18022140)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19185954
GRCz11 15 19121686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTCAACACCTCCGACAGACGCAAGCACTCATGATCCCAGTGAAGGG[T/C]AAGAAACAGCCTGCACACTTCACCTTCTCCGTGGGCTTTTGCCTGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108818 Essential Splice Site 320 1676 11 21
ENSDART00000136263   None 119 None 5
Genomic Location (Zv9):
Chromosome 15 (position 17951652)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19115466
GRCz11 15 19051198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTACATCTTGCATTGAGATTTTGAAGTCTGTTATTGTAATTTTCTGC[A/T]GTGTCTAAGAAGCATGGCAAGCTGATCACTTTTCTGCGCACGTTCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108818 Nonsense 383 1676 12 21
ENSDART00000136263   None 119 None 5
Genomic Location (Zv9):
Chromosome 15 (position 17951365)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19115179
GRCz11 15 19050911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCTTACAGTTCCTCAGGTCATCAGAAGCTGCACTGAGTTCATTGAG[A/T]GACATGGAGTTGTGGATGGGATTTACCGCTTGTCTGGAATCTCCTCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108818 Essential Splice Site 919 1676 20 21
ENSDART00000136263   None 119 None 5
Genomic Location (Zv9):
Chromosome 15 (position 17942410)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19106224
GRCz11 15 19041956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAAAGTAAATCTGCAGATGTAAAGCAGCACAGAAGAGCAGACTCAGG[T/C]CAGCAACCTTGCACAACCTTTCATTYATCTAAATAATCGAATGATACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108818 Nonsense 1248 1676 21 21
ENSDART00000136263   None 119 None 5
Genomic Location (Zv9):
Chromosome 15 (position 17939854)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19103668
GRCz11 15 19039400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGAAGACTACTCCTCAGTTGGTGTCTATAGACATGGAGGACCAAGGTA[T/A]CCACCGTTGGATGGAGCCTCCGTCTACCCAACTATCCGCAGGGTGCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108818 Nonsense 1445 1676 21 21
ENSDART00000136263   None 119 None 5
Genomic Location (Zv9):
Chromosome 15 (position 17939264)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19103078
GRCz11 15 19038810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAATGCACACCAGGAGCAGGTCAAACTCTGGGAAGGAGATGCTGATTT[C/A]AACTGAAGGGGCTGATGGGAAATACAGGGTCACKATGGTATCCCATTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link