si:dkeyp-22b2.2

Ensembl ID:
ENSDARG00000075333
ZFIN ID:
ZDB-GENE-041111-25
Description:
TBC1 domain family member 25 [Source:RefSeq peptide;Acc:NP_001121708]
Human Orthologue:
TBC1D25
Human Description:
TBC1 domain family, member 25 [Source:HGNC Symbol;Acc:8092]
Mouse Orthologue:
Tbc1d25
Mouse Description:
TBC1 domain family, member 25 Gene [Source:MGI Symbol;Acc:MGI:2444862]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45321 Nonsense Mutation detected in F1 DNA During 2018
sa10695 Nonsense Available for shipment Available now
sa41197 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083605 Nonsense 267 863 6 7
Genomic Location (Zv9):
Chromosome 8 (position 24520294)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23646112
GRCz11 8 23667351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGAGGAATTGGAGTTTATTCGGGGAAATGTTCTGAAAGATGTTCTT[C/T]GAACAGATCGAGCACATCCCTACTACGCGGGCTCAGAGGACAGCCCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083605 Nonsense 275 863 6 7
Genomic Location (Zv9):
Chromosome 8 (position 24520320)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23646138
GRCz11 8 23667377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATGTTCTGAAAGATGTTCTTCGAACAGATCGAGCACATCCCTACTA[C/A]GCGGGCTCAGAGGACAGCCCACATCTAACCGCCTTGACAGACCTTCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083605 Nonsense 485 863 7 7
Genomic Location (Zv9):
Chromosome 8 (position 24521033)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23646851
GRCz11 8 23668090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGGAGAGAGGTCCTCGGAAGGAAGGCGAAGGAGAGTATGATGTT[G/T]AAAGCATGGTCAGGAATGACATCCCTGCTCAGCCTCCTTCATTTGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link