
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-119d14.3
- Ensembl ID:
- ENSDARG00000075332
- ZFIN ID:
- ZDB-GENE-081104-100
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UX72]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34483 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31677 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa41291 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18257 | Essential Splice Site | Available for shipment | Available now |
sa21372 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34483
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110940 | Nonsense | 324 | 1025 | 3 | 11 |
ENSDART00000135138 | None | 169 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48178521)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46016779 GRCz11 8 46024658 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCATGTGCAAGTCTTTGGCGGATCAAGTCTCGCTCAAGGAAGACGTTT[T/A]AACAGAAATGGTGAGAGGAAAATGGTTCAGCAACAAAAAGAAAAGGCAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31677
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110940 | Nonsense | 447 | 1025 | 3 | 11 |
ENSDART00000135138 | None | 169 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48178151)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46016409 GRCz11 8 46024288 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCATCCCACTTTCAGAAGAGGACAGCGTCTCGGAAAACAATCATGTGTA[T/A]CCACCGAGAGGTCTGGGATTGGAGTATATGGTGAATTACATTCTTCAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41291
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110940 | Nonsense | 562 | 1025 | 4 | 11 |
ENSDART00000135138 | None | 169 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48177730)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46015988 GRCz11 8 46023867 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAAGACCGTCTGCATAACTTCAATGATCACGTCATCCTTGACTTTCCTT[T/A]ATGCATAACCTTAAGGCATCTTCTACAGGTAATAATAATAATATTCCTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18257
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110940 | Essential Splice Site | 639 | 1025 | 5 | 11 |
ENSDART00000135138 | None | 169 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48174616)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46012874 GRCz11 8 46020753 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCAGTGGTGATCATGGGTTTTCACAAACACAGCGMTTCTCTGTTATCAG[G/A]TATKGCAGCTGTAAAGCAGTTCATTTGCTAGTTTGCTTCACAGAAAATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21372
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110940 | Nonsense | 699 | 1025 | 7 | 11 |
ENSDART00000135138 | None | 169 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48172635)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46010893 GRCz11 8 46018772 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTACCACCAAATTATCACTTTTGGGCTCCTTGGATAGGTAAAAAAACA[C/T]GACATTCAGACACGGTGTTAAACACAGAATTTGAGAAAGTTTGTCCCTCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: