si:dkey-29n19.1

Ensembl ID:
ENSDARG00000075328
ZFIN ID:
ZDB-GENE-091113-11
Human Orthologue:
ARHGAP21
Human Description:
Rho GTPase activating protein 21 [Source:HGNC Symbol;Acc:23725]
Mouse Orthologue:
Arhgap21
Mouse Description:
Rho GTPase activating protein 21 Gene [Source:MGI Symbol;Acc:MGI:1918685]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109650 Nonsense 75 1953 2 28
ENSDART00000133291   None 708 None 17
Genomic Location (Zv9):
Chromosome 24 (position 6704041)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6544111
GRCz11 24 6573440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCGCACCTCTCACGGCTTCGGCTTCACGCTCCGTCACTTCATCGTTTA[T/A]CCACCTGAGTCAGCCGTGCAGTCCTCTCTCAAGGTCAGTACACAGCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link