zgc:56062

Ensembl ID:
ENSDARG00000075323
ZFIN ID:
ZDB-GENE-040426-1991
Description:
hypothetical protein LOC406321 [Source:RefSeq peptide;Acc:NP_998213]
Human Orthologue:
SRFBP1
Human Description:
serum response factor binding protein 1 [Source:HGNC Symbol;Acc:26333]
Mouse Orthologue:
Srfbp1
Mouse Description:
serum response factor binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914472]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44918 Nonsense Mutation detected in F1 DNA During 2018
sa39250 Nonsense Mutation detected in F1 DNA During 2018
sa29224 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112167 Nonsense 46 772 2 3
Genomic Location (Zv9):
Chromosome 19 (position 29784841)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 29714863
GRCz11 19 29302086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCGTCAAATCTCAGCCCTGCAGAAGAAGAAAGGAAATGAGGCGAGCT[T/A]GGAGAAAAATGGCAGGCGAGCAGCGAGACTTCGAGAGGAGATCCGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112167 Nonsense 255 772 3 3
Genomic Location (Zv9):
Chromosome 19 (position 29781713)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 29711735
GRCz11 19 29298958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTTTTCTAAAGAAGAAGAAAGGTGAGGAATATGAGGTGAAGGAAAGC[C/T]AAGAGAGAGCAGCAGTTCTTCTGAAAGAAATCCAGGCTTTAAGGAGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112167 Nonsense 354 772 3 3
Genomic Location (Zv9):
Chromosome 19 (position 29781416)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 29711438
GRCz11 19 29298661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACACGGTGCAGTCCAAGAATGAAGATGAGGAACTGGAAGAGGAAGAT[G/T]AGGAGGAGGTAGATGATGATGATAATGATGATGATGATGACGATGACGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link