zgc:171885

Ensembl ID:
ENSDARG00000075320
ZFIN ID:
ZDB-GENE-080220-43
Description:
hydroxyindole O-methyltransferase [Source:RefSeq peptide;Acc:NP_001108381]
Human Orthologue:
ASMT
Human Description:
acetylserotonin O-methyltransferase [Source:HGNC Symbol;Acc:750]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30507 Nonsense Mutation detected in F1 DNA During 2018
sa38232 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111787 Nonsense 106 275 3 7
Genomic Location (Zv9):
Chromosome Zv9_NA998 (position 24528)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56393764
GRCz11 9 55743426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAATGTGTTCCTGGTCAAGTCCAGCCCGAAGTCTCTGTATCACTCTATC[G/T]AGTACAGCTCCAGAACCATCTACCTGTGCTGGCATTACCTGAGCGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111787 Essential Splice Site 187 275 5 7
Genomic Location (Zv9):
Chromosome Zv9_NA998 (position 22890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACAGCCTTCGACCTGACACCGTACAAGACCATCTGTGACCTCGGAGG[T/C]AAGAAGTAGATCACACACACACACACACACTCTCTCTCTCTCTCTATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link