zgc:171872

Ensembl ID:
ENSDARG00000075307
ZFIN ID:
ZDB-GENE-080220-37
Description:
hypothetical protein LOC100141342 [Source:RefSeq peptide;Acc:NP_001108379]
Human Orthologue:
KCNQ2
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 2 [Source:HGNC Symbol;Acc:6296]
Mouse Orthologue:
Kcnq2
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 2 Gene [Source:MGI Symbol;Acc:MGI:1309503]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44687 Nonsense Mutation detected in F1 DNA During 2018
sa21297 Nonsense Available for shipment Available now
sa492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113492 Nonsense 166 349 3 7
ENSDART00000131736 Nonsense 166 883 3 18
Genomic Location (Zv9):
Chromosome 8 (position 26257675)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25385593
GRCz11 8 25404732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCTGTCGCTACAGAGGATGGAGAGGAAGGCTGAGATTTGCTCGC[A/T]AACCCTTCTGTATCATCGGTTAGAAAATCATCTGCTCTCTTTCTTTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113492 Nonsense 223 349 4 7
ENSDART00000131736 Nonsense 223 883 4 18
Genomic Location (Zv9):
Chromosome 8 (position 26252842)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25380760
GRCz11 8 25399899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAATGCTGCGAATGGACCGGCGCGGTGGCACATGGAAGCTCCTGGGAT[C/A]AGTCGTCTATGCGCACAGCAAGGTGACTAATAACATGCTTGATTTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113492   None 349 None 7
ENSDART00000131736 Nonsense 384 883 9 18
Genomic Location (Zv9):
Chromosome 8 (position 26245699)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25373617
GRCz11 8 25392756
KASP Assay ID:
554-0179.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCATTAGATTTCATTAAGCAGAAACACACTTCTCAGCAATTTATGG[C/T]AGTTTGATATGCTGTTGGTACTGTAGGCATTTAAAAGTCTGCTCCCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link