si:dkeyp-14d3.1

Ensembl ID:
ENSDARG00000075277
ZFIN ID:
ZDB-GENE-081104-459
Description:
Novel protein similar to vertebrate transmembrane protein 132D (TMEM132D) [Source:UniProtKB/TrEMBL;A
Human Orthologues:
TMEM132C, TMEM132D
Human Descriptions:
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
Mouse Orthologues:
Tmem132c, Tmem132d
Mouse Descriptions:
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34449 Nonsense Mutation detected in F1 DNA During 2018
sa21341 Nonsense Available for shipment Available now
sa307 Nonsense Confirmed mutation in F2 line During 2018
sa2456 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa34449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111021 Nonsense 48 719 2 8
ENSDART00000143243 Nonsense 23 296 1 1
ENSDART00000144520   None 665 None 5
Genomic Location (Zv9):
Chromosome 8 (position 36691827)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 35627663
GRCz11 8 35357011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGAATCTTCAACGCTACGCTTCCCCTACTTACCTACCCGTTAACTA[T/A]CAACTCCTCAACACAGAATCCTCTTTCTTCCTTAAGGAGGCCACCCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111021 Nonsense 349 719 3 8
ENSDART00000143243   None 296 None 1
ENSDART00000144520   None 665 None 5
Genomic Location (Zv9):
Chromosome 8 (position 36811927)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 35747763
GRCz11 8 35477111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTGCTCGACCCTGTAACCCCACGCTCTGGATGGTTAGTCAAGACGTC[A/T]GAACAGAAGGACATAGGATTGTGACGCTGCATTGTCGTCGTAAAGAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa307
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111021 Nonsense 682 719 8 8
ENSDART00000143243   None 296 None 1
ENSDART00000144520 Nonsense 250 665 4 5
Genomic Location (Zv9):
Chromosome 8 (position 37072514)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36008350
GRCz11 8 35737698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCACTGAACTGGGCCTGCAGTTGGTCAGTGGTCTCACACTCAACCTT[C/T]AGCTCAGTACAGGAAGCAACCGAGCCATCAGTGCCACAGCAACCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2456
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111021   None 719 None 8
ENSDART00000143243   None 296 None 1
ENSDART00000144520 Nonsense 516 665 5 5
Genomic Location (Zv9):
Chromosome 8 (position 37094570)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36030406
GRCz11 8 35759754
KASP Assay ID:
554-3281.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGGTCTTCCTCATCAACTGYATCTCGTACACCCTAAAGTACCGGCAC[A/T]AGGAGATGTCGATCGAGGGCCAGGAGAGCATGAATCACGCACACGATTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link