si:dkey-252g6.1

Ensembl ID:
ENSDARG00000075265
ZFIN ID:
ZDB-GENE-090313-278
Description:
plasminogen activator, urokinase a [Source:RefSeq peptide;Acc:NP_001165872]
Human Orthologue:
PLAU
Human Description:
plasminogen activator, urokinase [Source:HGNC Symbol;Acc:9052]
Mouse Orthologue:
Plau
Mouse Description:
plasminogen activator, urokinase Gene [Source:MGI Symbol;Acc:MGI:97611]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42206 Nonsense Mutation detected in F1 DNA During 2018
sa35486 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110064 Nonsense 41 402 4 11
ENSDART00000133153   None 324 None 7
Genomic Location (Zv9):
Chromosome 13 (position 25527220)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25172880
GRCz11 13 25303330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATATATAGGTTTAATCATGACTTTTCTCTTCTTAGGCAAGTGCATAT[T/G]AGACAGAGATGAGAGCAAATACACAGGAAAAGTGTCAGTGACTGTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110064 Nonsense 243 402 9 11
ENSDART00000133153 Nonsense 180 324 5 7
Genomic Location (Zv9):
Chromosome 13 (position 25524129)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25169789
GRCz11 13 25300239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAAATAAAATAAATAAATAACACTCTAAATCTTTTCCTTCAGCTCTGT[T/A]GAAGATAGAGGACTGCAATGGACAATGTGCAGTAAAGACAAAAACTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link