zgc:112970

Ensembl ID:
ENSDARG00000075258
ZFIN ID:
ZDB-GENE-050327-83
Description:
hypothetical protein LOC541543 [Source:RefSeq peptide;Acc:NP_001014379]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38159 Nonsense Mutation detected in F1 DNA During 2018
sa44383 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110036 Nonsense 96 591 4 14
Genomic Location (Zv9):
Chromosome Zv9_scaffold3536 (position 200517)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149696.1 168302
GRCz11 KN149696.2 168302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGAAGTGCAACTGCAGGGGGAAAAACAATGTTGTATATTGTTCCTTTA[C/T]AATATGAGTTTGACCTGTCACCACTACCATCTGATGCCCAGGAGTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110036 Nonsense 169 591 5 14
Genomic Location (Zv9):
Chromosome Zv9_scaffold3536 (position 200819)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149696.1 168000
GRCz11 KN149696.2 168000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGTCCAATCTACCTCCTGATTCACCCGATTTATCTCCTGCTACTGAA[G/T]AAAAGGTAATCACCCAGTTGCTTGGGTTGACATTATTCTTACTTCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link