wu:fb92a07

Ensembl ID:
ENSDARG00000075253
ZFIN ID:
ZDB-GENE-030131-1904
Human Orthologue:
PIK3CB
Human Description:
phosphoinositide-3-kinase, catalytic, beta polypeptide [Source:HGNC Symbol;Acc:8976]
Mouse Orthologue:
Pik3cb
Mouse Description:
phosphatidylinositol 3-kinase, catalytic, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:1922019]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42487 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa42488 Nonsense Mutation detected in F1 DNA During 2018
sa45529 Nonsense Mutation detected in F1 DNA During 2018
sa16592 Nonsense Available for shipment Available now
sa16161 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114560 Splice Site, Nonsense 200 1080 3 22
Genomic Location (Zv9):
Chromosome 15 (position 7058398)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7133967
GRCz11 15 7130764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAGGCATGAGGGCATAATTAAAATCACCATGCACTACGACCAGTCA[C/T]AGGTAGATCTGTTTTTTATTCAGGATATGGCCTATTACATATGTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114560 Nonsense 224 1080 4 22
Genomic Location (Zv9):
Chromosome 15 (position 7058567)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7134136
GRCz11 15 7130933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTTGAATTGTACAGTATCTGAAGTAATGGATCATGCTCTCAAGAAATG[G/A]CAGACTACTCATGGGCCAGAGGAAGACATTGGTGCCCGTAGCAATTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114560 Nonsense 483 1080 9 22
Genomic Location (Zv9):
Chromosome 15 (position 7068590)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7144159
GRCz11 15 7140956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGGAAATGCCTTTTCCTGTATGTTGCAGATGAGCTGGAAGAGATGT[T/A]GAACCCTATCGGCACCATTCAGACCAATCCATACACAGAGAATGCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114560 Nonsense 710 1080 14 22
Genomic Location (Zv9):
Chromosome 15 (position 7073343)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7148912
GRCz11 15 7145709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCCAGCTGTATCGGTTCATTTTGCTCTGATCTTGGAAGCMTACTGC[A/T]GAGGCTGCATCCCACACATTGAAGTTCTCWAAAAACAGGTGCCAAATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114560 Nonsense 908 1080 19 22
Genomic Location (Zv9):
Chromosome 15 (position 7085532)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7161101
GRCz11 15 7157898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTCAAATCTGATTGGCATCATGATGTTTTAACAGGGATGCTTTGGAC[A/T]AAGCCATTGAGGAGTTCACTCTATCATGTGCTGGTTATTGTGTTGCCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link