zgc:172133

Ensembl ID:
ENSDARG00000075248
ZFIN ID:
ZDB-GENE-080204-48
Description:
Zgc:172133 protein [Source:UniProtKB/TrEMBL;Acc:A8WG19]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37420 Nonsense Available for shipment Available now
sa11082 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081687 Nonsense 158 396 3 6
Genomic Location (Zv9):
Chromosome 22 (position 6384053)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6430120
GRCz11 22 6459966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGGTGTTCAAACAAACCAAAGCAACAGAATTAACTGGTATTTTAAT[A/T]AAGGGCGCATTGCTGAAATAATAGGCTATCGGCGTAAAGTCTGCGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081687 Nonsense 262 396 4 6
Genomic Location (Zv9):
Chromosome 22 (position 6382201)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6428268
GRCz11 22 6458114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRCTCCTWTTAAAACAACTCCAAATGATGTGCTGAAGTGGTACTTTGGY[G/T]AGATTCTCCTYGCTGAAATMACTGGARRTSMGAGTCAGRTCTGTGAAGAW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link