Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000075240
- Ensembl ID:
- ENSDARG00000075240
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa10067 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10067
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000064979 | Nonsense | 92 | 264 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 6 (position 7832520)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 9658527 GRCz11 6 9894066 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATCCRGATGCTGGAGTGGCAGGAGAGGTCTGACTCCTACATAATGATCT[T/A]GGAGCGTCCCTCACCCTGCGAAGACCTDTTTGAYTTCCTGGAGCGGCACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
