zgc:172282

Ensembl ID:
ENSDARG00000075231
ZFIN ID:
ZDB-GENE-080219-38
Description:
Leucine-rich repeat and fibronectin type III domain-containing protein 1-like protein [Source:UniPro
Human Orthologues:
LRFN1, LRFN2, LRFN4, LRFN5
Human Descriptions:
leucine rich repeat and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:29290]
leucine rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;Acc:21226]
leucine rich repeat and fibronectin type III domain containing 4 [Source:HGNC Symbol;Acc:28456]
leucine rich repeat and fibronectin type III domain containing 5 [Source:HGNC Symbol;Acc:20360]
Mouse Orthologues:
Lrfn1, Lrfn2, Lrfn4, Lrfn5
Mouse Descriptions:
leucine rich repeat and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:213
leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:191
leucine rich repeat and fibronectin type III domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:238
leucine rich repeat and fibronectin type III domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:214

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35814 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111384 Essential Splice Site None 687 6 6
Genomic Location (Zv9):
Chromosome 15 (position 11472067)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 13158495
GRCz11 15 13107732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTTTCTGCCAAGGGCTCTAATCCTGTCTCTTTCTCTTGTTTCCTCC[A/G]GATATTCATCACCCTTCATCCATCCAATCATGCAAACTGCACCAGTGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link