zgc:165647

Ensembl ID:
ENSDARG00000075222
ZFIN ID:
ZDB-GENE-070719-5
Description:
hypothetical protein LOC100101649 [Source:RefSeq peptide;Acc:NP_001093622]
Human Orthologue:
FAM123A
Human Description:
family with sequence similarity 123A [Source:HGNC Symbol;Acc:26360]
Mouse Orthologue:
Fam123a
Mouse Description:
family with sequence similarity 123, member A Gene [Source:MGI Symbol;Acc:MGI:1919375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37898 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115165 Nonsense 406 654 1 1
Genomic Location (Zv9):
Chromosome 24 (position 25678916)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24925794
GRCz11 24 25070968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTAAAAAGCCACAGGGTAGTGGAGTTGTTGCTTACATGGGTGGAGGG[G/T]AAGAAATGGCTAGTCCTGAGGGTGTTGATGATGCTGATATGCAGGGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link