A3KNL1_DANRE

Ensembl ID:
ENSDARG00000075219
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A3KNL1]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39959 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055053   None 386 None 2
ENSDART00000058879 Nonsense 235 302 2 2
ENSDART00000124598   None 370 None 2
ENSDART00000125447 Nonsense 609 648 6 6
Genomic Location (Zv9):
Chromosome 2 (position 58904803)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58218008
GRCz11 2 58146679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGAAGCCGTTTCGTGGCCTTCAACAACAAAAACCTTGAAAACCGAGAA[C/T]AAGTGACACGACTCCTTCAGAAAGTGGATGAACTGATGATCCAGAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link