chd7

Ensembl ID:
ENSDARG00000075211
ZFIN ID:
ZDB-GENE-070912-179
Description:
LOC569471 protein [Source:UniProtKB/TrEMBL;Acc:A7E291]
Human Orthologue:
CHD7
Human Description:
chromodomain helicase DNA binding protein 7 [Source:HGNC Symbol;Acc:20626]
Mouse Orthologue:
Chd7
Mouse Description:
chromodomain helicase DNA binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2444748]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32899 Nonsense Mutation detected in F1 DNA During 2018
sa596 Nonsense F2 line generated During 2018
sa19733 Nonsense Available for shipment Available now
sa44530 Nonsense Mutation detected in F1 DNA During 2018
sa6835 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32898 Nonsense Mutation detected in F1 DNA During 2018
sa44529 Nonsense Mutation detected in F1 DNA During 2018
sa39811 Nonsense Mutation detected in F1 DNA During 2018
sa19732 Nonsense Available for shipment Available now
sa11593 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 39 3140 1 37
ENSDART00000114089 Nonsense 39 653 2 3
ENSDART00000121586 Nonsense 39 62 2 2
ENSDART00000135230 Nonsense 39 3140 2 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21604321)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22149736
GRCz11 2 21807798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCCTAGGGGACTGTGGCTACCCTCAAGGTCAGACAAATCCTATGAGT[C/T]AACAGATGCCCCATGAGCACCAAGGCTATGGGCAGCTTCCTCCTTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa596
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 40 3140 1 37
ENSDART00000114089 Nonsense 40 653 2 3
ENSDART00000121586 Nonsense 40 62 2 2
ENSDART00000135230 Nonsense 40 3140 2 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21604318)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22149733
GRCz11 2 21807795
KASP Assay ID:
554-0506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTAGGGGACTGTGGCTACCCTCAAGGTCAGACAAATCCTATGAGTCAA[C/T]AGATGCCCCATGAGCACCAAGGCTATGGGCAGCTTCCTCCTTCTCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 377 3140 1 37
ENSDART00000114089 Nonsense 377 653 2 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 377 3140 2 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21603307)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22148722
GRCz11 2 21806784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACCCTGCTCCGGCAGGGCCTCAGCGCTACCCTACACCTGGGGGTCAA[C/T]AGGGACCATTGCACCAGCAGCCCATTCATGTGAACCAAATCAATACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 853 3140 5 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 853 3140 6 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21581940)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22127355
GRCz11 2 21785417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTTGCCGGATGCGGAAGGTCCTGTGGTGGAGAAGATCATGGGGATG[C/T]GAATGGGAAAGAAAGAGGTGAGCTGAGCCGCTGAAAGCCTCTCACACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Essential Splice Site 859 3140 6 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Essential Splice Site 859 3140 7 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21581122)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22126537
GRCz11 2 21784599
KASP Assay ID:
554-4054.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATGCACCCTTTTCAAACAACTAATTAATGTTTCTGCTTATTTTACA[G/A]TTGGCGTCTGGTGAAGAGATAGAAGTCGAAGAGTTTTACGTCAAATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 962 3140 9 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 962 3140 10 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21579824)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22125239
GRCz11 2 21783301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTGTACCTGGTAAAGTGGTGCTCCTTGCCTTATGAGGACAGCACGT[G/A]GGAGTTAAAAGCTGACATAGACCAAGTGAAGATTGAGGAGTTTGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 1033 3140 11 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 1033 3140 12 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21579346)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22124761
GRCz11 2 21782823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTGAGTTGTTGTTTTTTTTTTTTTTTTTTTTTCCTCAGACGAAACTG[C/A]ATTTTAGCTGATGAAATGGGACTTGGTAAAACAATCCAATCCATCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 1433 3140 16 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 1433 3140 17 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21577302)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22122717
GRCz11 2 21780779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAAGGGCTGGTGGCTTGGGTATTAACCTAACTGCAGCTGATACATG[T/A]ATTATATTTGATTCTGACTGGAACCCTCAAAATGACCTGCAGGTAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 1449 3140 17 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 1449 3140 18 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21577023)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22122438
GRCz11 2 21780500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCTCAAAGGCGGTGTATGTGACCGGTTTGTGCTGTTGCCTCCAGGCA[C/T]AAGCTCGATGCCACAGGATAGGACAGAGCAAGTCTGTGAAGATTTACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 1541 3140 18 37
ENSDART00000114089   None 653 None 3
ENSDART00000121586   None 62 None 2
ENSDART00000135230 Nonsense 1541 3140 19 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21576493)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22121908
GRCz11 2 21779970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGGAAGAGGAGGATGAGGGATCCAAGTTCTGTGAAGAAGACATTGAT[C/T]AGATTTTGCAGAGAMGTACACAGACCAKTACAATTGAATCAGAAGGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link