zgc:195212

Ensembl ID:
ENSDARG00000075203
ZFIN ID:
ZDB-GENE-081022-196
Description:
hypothetical protein LOC100189619 [Source:RefSeq peptide;Acc:NP_001128617]
Human Orthologue:
C11orf80
Human Description:
chromosome 11 open reading frame 80 [Source:HGNC Symbol;Acc:26197]
Mouse Orthologue:
Gm960
Mouse Description:
predicted gene 960 Gene [Source:MGI Symbol;Acc:MGI:2685806]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35749 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42440 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128881 Essential Splice Site 45 562 2 16
Genomic Location (Zv9):
Chromosome 14 (position 47012795)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 44329922
GRCz11 14 44791234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGTTGTCGTGAGAGCTCTGCGTGAATCACCTGCGACTTTAACCGG[T/G]AAAACACGAAGACACTACAGTCAAACTTTACTTAACGTTACTAGACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128881 Essential Splice Site 546 562 15 16
Genomic Location (Zv9):
Chromosome 14 (position 47024465)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 44341592
GRCz11 14 44802904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCAGAATGACTGAAGACAAACCCTCAGTTAAACTGATAAATGAACAG[G/A]TTGATACATCTATAGCTACAGTTTAAGTCAGAATTATTAGCACCCTGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link