ULK3

Ensembl ID:
ENSDARG00000075200
Description:
unc-51-like kinase 3 (C. elegans) [Source:HGNC Symbol;Acc:19703]
Human Orthologue:
ULK3
Human Description:
unc-51-like kinase 3 (C. elegans) [Source:HGNC Symbol;Acc:19703]
Mouse Orthologue:
Ulk3
Mouse Description:
unc-51-like kinase 3 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1918992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32183 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23210 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109230 Essential Splice Site 50 429 1 17
ENSDART00000109230 Essential Splice Site 50 429 1 17
Genomic Location (Zv9):
Chromosome 18 (position 5016664)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5705335
GRCz11 18 5619980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAAGACGGTCCGGCATCCTCATATAGTGCAGCTCAAAGACTTCCAG[G/A]TGAACTTAAGCCAAGATATTCATTATAAAGCACACTGCGCTGACGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109230 Essential Splice Site 50 429 1 17
ENSDART00000109230 Essential Splice Site 50 429 1 17
Genomic Location (Zv9):
Chromosome 18 (position 5016664)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5705335
GRCz11 18 5619980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAAGACGGTCCGGCATCCTCATATAGTGCAGCTCAAAGACTTCCAG[G/A]TGAACTTAAGCCAAGATATTCATTATAAAGCACACTGCGCTGACGTGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link