si:dkey-56e3.3

Ensembl ID:
ENSDARG00000075194
ZFIN ID:
ZDB-GENE-050411-91
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4C5]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31220 Essential Splice Site Available for shipment Available now
sa39660 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111367 Essential Splice Site 149 575 2 8
Genomic Location (Zv9):
Chromosome 1 (position 41979242)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40895558
GRCz11 1 41596722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTCTTCAAACTCCTCAGTTTTACAACAACAACAAAGGCTTGACCAGG[T/C]CTGCACAACCAACACCTGGAACTGATTATATACAGTCAGATTATTTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111367 Nonsense 178 575 3 8
Genomic Location (Zv9):
Chromosome 1 (position 41981795)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40898111
GRCz11 1 41599275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGTTCTCATTATTAAAGAGGAGAGGCCTGAAAACACGAGGTGTGAA[C/T]AGTCTGAAAGAGAAAAACAGACCACCGAGAATCGTGAGTATGGGAGGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link