
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-45m5.4
- Ensembl ID:
- ENSDARG00000075188
- ZFIN ID:
- ZDB-GENE-081104-414
- Description:
- A disintegrin and metalloproteinase with thrombospondin motifs 10 [Source:RefSeq peptide;Acc:NP_001
- Human Orthologue:
- ADAMTS10
- Human Description:
- ADAM metallopeptidase with thrombospondin type 1 motif, 10 [Source:HGNC Symbol;Acc:13201]
- Mouse Orthologue:
- Adamts10
- Mouse Description:
- a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 Gene
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38685 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34374 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa9421 | Nonsense | Available for shipment | Available now |
sa18917 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31645 | Nonsense | Available for shipment | Available now |
sa7130 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38685
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113910 | Nonsense | 87 | 1108 | 2 | 24 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20909904)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20339801 GRCz11 8 20371886 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCGGCGCAGCACCGAAACACAGAGCGCTCCAGAGCCGCAGCTGTACTA[T/A]CAGCTCTCCACTTCCAGCACTGATCTGCTGCTCAACCTCACGCTGCAGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34374
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113910 | Essential Splice Site | 208 | 1108 | 3 | 24 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20906930)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20336827 GRCz11 8 20368912 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTCGTCTCTGAGATATCAGAACATGGACCAGTCCTGTGGAGTTATCGG[T/G]AAGAACCAAAAAGTTTGTAAGTTTTAAATGAAATTTGTTTGCCAACCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9421
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113910 | Nonsense | 495 | 1108 | 10 | 24 |
ENSDART00000113910 | Nonsense | 495 | 1108 | 10 | 24 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20886702)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20316599 GRCz11 8 20348684 - KASP Assay ID:
- 2260-0458.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATGCAGACGAGCAGTGCCGCTTCCAGTACGGAGTGAAGTCTCRTCAGTG[T/A]AAATACGGGGTACTTGCATCACTACGTGTAACAACARCTCTTTTTTCCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18917
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113910 | Nonsense | 495 | 1108 | 10 | 24 |
ENSDART00000113910 | Nonsense | 495 | 1108 | 10 | 24 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20886702)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20316599 GRCz11 8 20348684 - KASP Assay ID:
- 2260-0458.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGCAGACGAGCAGTGCCGCTTCCAGTACGGAGTGAAGTCTCGTCAGTG[T/A]AAATACGGGGTACTTGCATCACTACGTGTAACAACAGCTCTTTTTTCCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31645
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113910 | Nonsense | 818 | 1108 | 19 | 24 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20847797)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20277694 GRCz11 8 20309779 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTAATGTGTGGCAGGTCTTGGTCCGTGAAGAGAATCCAGGAATTCTATA[T/A]CGATTCAACCCTCCAGTCAGCAGAGATCCTCTGAGCAGTTACTCTTGGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7130
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113910 | Nonsense | 1062 | 1108 | 23 | 24 |
- Genomic Location (Zv9):
- Chromosome 8 (position 20839202)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 20269099 GRCz11 8 20301184 - KASP Assay ID:
- 554-4688.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCCCTGAGTCTCATCGTCCAGCCTTCATGCAGCAGTGCAAGAGCAAGTG[C/A]GACCACAGCGGCCCTACAGACAACCCTGAAGGTCAGAGGTCAAACAAAAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
- Height: Many sequence variants affecting diversity of adult human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: