zgc:171573

Ensembl ID:
ENSDARG00000075177
ZFIN IDs:
ZDB-GENE-050411-27, ZDB-GENE-050411-27
Description:
Zgc:171573 protein [Source:UniProtKB/TrEMBL;Acc:B0JZB6]
Human Orthologue:
RIBC2
Human Description:
RIB43A domain with coiled-coils 2 [Source:HGNC Symbol;Acc:13241]
Mouse Orthologue:
Ribc2
Mouse Description:
RIB43A domain with coiled-coils 2 Gene [Source:MGI Symbol;Acc:MGI:1914997]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12183 Nonsense Available for shipment Available now
sa14353 Nonsense Available for shipment Available now
sa17943 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110859 Nonsense 48 236 2 6
ENSDART00000124729 Nonsense 48 367 2 7
ENSDART00000110859 Nonsense 48 236 2 6
ENSDART00000124729 Nonsense 48 367 2 7
Genomic Location (Zv9):
Chromosome 25 (position 17112076)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16658620
GRCz11 25 16755020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGACACGTTTTTTNNGTTTTGTCAGGTTGATATAGATGCTCTTGGCCAA[C/A]AAATTAAGGAGCGAAGAGAGAAAGAGCAGAGAGAAGCGAATGAGCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110859 Nonsense 48 236 2 6
ENSDART00000124729 Nonsense 48 367 2 7
ENSDART00000110859 Nonsense 48 236 2 6
ENSDART00000124729 Nonsense 48 367 2 7
Genomic Location (Zv9):
Chromosome 25 (position 17112076)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16658620
GRCz11 25 16755020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGACACGTTTTTTNNGTTTTGTCAGGTTGATATAGATGCTCTTGGCCAA[C/T]AAATTAAGGAGCGAAGAGAGAAAGAGCAGAGAGAAGCGAATGAGCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110859 Nonsense 78 236 3 6
ENSDART00000124729 Nonsense 78 367 3 7
Genomic Location (Zv9):
Chromosome 25 (position 17111507)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16658051
GRCz11 25 16754451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTATGTTTCTAGCGGATGACCTACTGTGCAGTGATGGTATAGCCTG[T/A]ATCCTGGARCAGCGGCAGAAGAAAGATGAGCGGCAGCTGAATAAGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link