anpep

Ensembl ID:
ENSDARG00000075168
ZFIN IDs:
ZDB-GENE-030131-1253, ZDB-GENE-030131-1253
Description:
aminopeptidase N [Source:RefSeq peptide;Acc:NP_001082794]
Human Orthologue:
ANPEP
Human Description:
alanyl (membrane) aminopeptidase [Source:HGNC Symbol;Acc:500]
Mouse Orthologue:
Anpep
Mouse Description:
alanyl (membrane) aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:96749]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38017 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113391 Essential Splice Site 649 965 12 20
ENSDART00000126535   None 965 None 20
Genomic Location (Zv9):
Chromosome 25 (position 11034620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCAAAACTGGGAACGCCTGCTTAATGCTCTCCAGACATCCAGAGAG[G/A]TAAGGAGAAATATGTTTATTAACAATTCAGCCAAATTGTTATGAGTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link