wu:fb95h02

Ensembl ID:
ENSDARG00000075164
ZFIN IDs:
ZDB-GENE-030131-2068, ZDB-GENE-050309-74
Description:
Im:7148400 protein [Source:UniProtKB/TrEMBL;Acc:A8WGC7]
Human Orthologue:
MYLK
Human Description:
myosin light chain kinase [Source:HGNC Symbol;Acc:7590]
Mouse Orthologue:
Mylk
Mouse Description:
myosin, light polypeptide kinase Gene [Source:MGI Symbol;Acc:MGI:894806]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33208 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113441 Essential Splice Site 256 856 6 17
Genomic Location (Zv9):
Chromosome 3 (position 31815746)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31547056
GRCz11 3 31678770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGGCAGCTCACCTGTAGCATCTTGCTGGGTCTTTAACAAAAAAGAGG[T/A]ACATCATCTAACACAACATAACACAATTAAGACGTCCATATCATTCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link