
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mfi2
- Ensembl ID:
- ENSDARG00000075159
- ZFIN ID:
- ZDB-GENE-050309-40
- Human Orthologue:
- MFI2
- Human Description:
- antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 [Source:HGNC Sy
- Mouse Orthologue:
- Mfi2
- Mouse Description:
- antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene [Source:MG
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20718 | Nonsense | Available for shipment | Available now |
sa31511 | Nonsense | Available for shipment | Available now |
sa31512 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20718
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088403 | Nonsense | 209 | 723 | 5 | 16 |
- Genomic Location (Zv9):
- Chromosome 6 (position 29808344)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 30103987 GRCz11 6 30094548 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGGACAATTTAAGTGTGATCCAAGCAACAAGGAGCTGTATTACGCATA[T/A]GATGGAGCATTCAGGTGTTGTATTCTTTGTTTTTTCATACAGAACTGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31511
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088403 | Nonsense | 339 | 723 | 8 | 16 |
- Genomic Location (Zv9):
- Chromosome 6 (position 29811626)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 30107269 GRCz11 6 30097830 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACCAAATTCATTCAAGCCGGAAATGAAAACTATAAGGAATGGATGGGA[C/T]GATACTATCACATACTGAAAGCTATGGACTGCTCACAGTCAGGTGTGAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31512
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088403 | Nonsense | 444 | 723 | 11 | 16 |
- Genomic Location (Zv9):
- Chromosome 6 (position 29815440)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 30111083 GRCz11 6 30101644 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCACAAACCCCTGTGATTCTTTAGGAGACAGTGATGGAAGCATTTATTA[C/A]GCCGTGGCTGTGCTGAGAAAGAGCAACAGAGACATCCAGAGATTCAGCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: